Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1055448
End position: 1055471
Length: 24

DNA sequence
>NC_015064, from 1055448 to 1055471 (24 bp); Acidobacterium sp. MP5ACTX9 GCCGGTGCCGGTGTCGGTGACGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1055221-1057602	Sequence	AciX9_0883 - multi-sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1057602 to 1055221)