Sequence retrieval

Genome: Acidobacterium sp. MP5ACTX9
Start position: 1049188
End position: 1049232
Length: 45

DNA sequence
>NC_015064, from 1049188 to 1049232 (45 bp); Acidobacterium sp. MP5ACTX9 TTGGGCGGCAGTCTGCTGGGCGTCGGTCTGCTGGACGTCAGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1047926-1049287	Sequence	AciX9_0877 - amidohydrolase (Protein is coded in complementary strand; from 1049287 to 1047926)