Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 993504
End position: 993539
Length: 36

DNA sequence
>NC_014974, from 993504 to 993539 (36 bp); Thermus scotoductus SA-01 CCTGAAGCCGGCCCTGGAGCGGGCCTTGAAGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 992561-993733	Sequence	TSC_c10480 - leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein