Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 972128
End position: 972163
Length: 36

DNA sequence
>NC_014974, from 972128 to 972163 (36 bp); Thermus scotoductus SA-01 ATGGCCTCCTTGATGGTTTCCTTGATGGCCTCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 971786-972172	Sequence	TSC_c10250 - hypothetical protein (Protein is coded in complementary strand; from 972172 to 971786)