Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 676704
End position: 676733
Length: 30

DNA sequence
>NC_014974, from 676704 to 676733 (30 bp); Thermus scotoductus SA-01 AGGGTCAGGGCCAGGTTCAGGGTAAGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 675669-678170	Sequence	TSC_c07360 - sensor histidine kinase (Protein is coded in complementary strand; from 678170 to 675669)