Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 341475
End position: 341498
Length: 24

DNA sequence
>NC_014974, from 341475 to 341498 (24 bp); Thermus scotoductus SA-01 CCAGGGCCAGGGCCCGGGCCAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 341267-341956	Sequence	TSC_c03960 lolD1 lipoprotein-releasing system ATP-binding protein LolD (Protein is coded in complementary strand; from 341956 to 341267)