Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 320818
End position: 320847
Length: 30

DNA sequence
>NC_014974, from 320818 to 320847 (30 bp); Thermus scotoductus SA-01 GGTGGTGATGGTGGTGGTGATGGTGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 318831-320855	Sequence	TSC_c03730 copB putative copper-transporting P-type ATPase B (Protein is coded in complementary strand; from 320855 to 318831)