Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2336231
End position: 2336254
Length: 24

DNA sequence
>NC_014974, from 2336231 to 2336254 (24 bp); Thermus scotoductus SA-01 CTCCACCTCCCCCTCCACCTCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2336148-2337116	Sequence	TSC_c24940 pfkA 6-phosphofructokinase (Protein is coded in complementary strand; from 2337116 to 2336148)