Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2303472
End position: 2303495
Length: 24

DNA sequence
>NC_014974, from 2303472 to 2303495 (24 bp); Thermus scotoductus SA-01 CCGCCACCCCCACGGCCACCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2303438-2303887	Sequence	TSC_c24580 - RNA methyltransferase, TrmH family, group 2 (Protein is coded in complementary strand; from 2303887 to 2303438)