Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2178758
End position: 2178781
Length: 24

DNA sequence
>NC_014974, from 2178758 to 2178781 (24 bp); Thermus scotoductus SA-01 GCCCTGGCCCGGGCCCTGGCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2178339-2179391	Sequence	TSC_c23190 - Fe(3+) ions import ATP-binding protein FbpC 1