Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 214469
End position: 214492
Length: 24

DNA sequence
>NC_014974, from 214469 to 214492 (24 bp); Thermus scotoductus SA-01 CCTCCACCCCCACCTCCGCCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 214153-214941	Sequence	TSC_c02550 - ApbE family (Protein is coded in complementary strand; from 214941 to 214153)