Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2111759
End position: 2111782
Length: 24

DNA sequence
>NC_014974, from 2111759 to 2111782 (24 bp); Thermus scotoductus SA-01 ACCGCCACCCCCACCCCCACCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2110733-2111854	Sequence	TSC_c22510 - lipoprotein releasing system transmembrane protein (Protein is coded in complementary strand; from 2111854 to 2110733)