Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2078783
End position: 2078812
Length: 30

DNA sequence
>NC_014974, from 2078783 to 2078812 (30 bp); Thermus scotoductus SA-01 CTTTCTTCTCCATCCTTCTCCTTTCTACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2077774-2078796	Sequence	TSC_c22010 - deoxyhypusine synthase (Protein is coded in complementary strand; from 2078796 to 2077774)