Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 2067095
End position: 2067118
Length: 24

DNA sequence
>NC_014974, from 2067095 to 2067118 (24 bp); Thermus scotoductus SA-01 GCCACCGCCGCCGCCATCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2066729-2067919	Sequence	TSC_c21910 coaBC phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase (Protein is coded in complementary strand; from 2067919 to 2066729)