Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 201220
End position: 201243
Length: 24

DNA sequence
>NC_014974, from 201220 to 201243 (24 bp); Thermus scotoductus SA-01 CAGGCCCAGGGCCAGGGCCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200435-201538	Sequence	TSC_c02400 acoA 2-oxoisovalerate dehydrogenase subunit alpha (Protein is coded in complementary strand; from 201538 to 200435)