Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1839666
End position: 1839689
Length: 24

DNA sequence
>NC_014974, from 1839666 to 1839689 (24 bp); Thermus scotoductus SA-01 GGCCACGGCCAAGGCCGCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1839163-1839828	Sequence	TSC_c19320 mtnN MTA/SAH nucleosidase (Protein is coded in complementary strand; from 1839828 to 1839163)