Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1583437
End position: 1583463
Length: 27

DNA sequence
>NC_014974, from 1583437 to 1583463 (27 bp); Thermus scotoductus SA-01 TGCGGTGGTTGCGGTGGTTGCGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1583237-1585120	Sequence	TSC_c16650 - bifunctional DNA primase/polymerase (Protein is coded in complementary strand; from 1585120 to 1583237)