Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1542540
End position: 1542566
Length: 27

DNA sequence
>NC_014974, from 1542540 to 1542566 (27 bp); Thermus scotoductus SA-01 CATCCACCGCAACCACCGCAACCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1542400-1542543	Sequence	TSC_c16070 - hypothetical protein (Protein is coded in complementary strand; from 1542543 to 1542400)