Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1485431
End position: 1485454
Length: 24

DNA sequence
>NC_014974, from 1485431 to 1485454 (24 bp); Thermus scotoductus SA-01 CCAAGGCCAGGGCCAGGGCCAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1484644-1485888	Sequence	TSC_c15450 cseC sensor protein CseC (Protein is coded in complementary strand; from 1485888 to 1484644)