Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1260731
End position: 1260754
Length: 24

DNA sequence
>NC_014974, from 1260731 to 1260754 (24 bp); Thermus scotoductus SA-01 CCACCTCCACCTCCCCCTCCCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1260226-1261248	Sequence	TSC_c13160 hslO chaperonin HslO (Protein is coded in complementary strand; from 1261248 to 1260226)