Sequence retrieval

Genome: Thermus scotoductus SA-01
Start position: 1004704
End position: 1004727
Length: 24

DNA sequence
>NC_014974, from 1004704 to 1004727 (24 bp); Thermus scotoductus SA-01 GGCCAGGGCTAGGGCCAAGGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1003829-1004968	Sequence	TSC_c10580 - major facilitator superfamily MFS_1 (Protein is coded in complementary strand; from 1004968 to 1003829)