Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 4970144
End position: 4970179
Length: 36

DNA sequence
>NC_014963, from 4970144 to 4970179 (36 bp); Terriglobus saanensis SP1PR4 AGCCGACGAGGGAACCGACAAGGGAGCCGACGAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4969858-4971438	Sequence	AciPR4_4168 - monooxygenase FAD-binding protein (Protein is coded in complementary strand; from 4971438 to 4969858)