Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 4879747
End position: 4879770
Length: 24

DNA sequence
>NC_014963, from 4879747 to 4879770 (24 bp); Terriglobus saanensis SP1PR4 CGCTGCCCCGCTGACCCGCTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4878277-4880166	Sequence	AciPR4_4082 - glucose inhibited division protein A (Protein is coded in complementary strand; from 4880166 to 4878277)