Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 4273522
End position: 4273566
Length: 45

DNA sequence
>NC_014963, from 4273522 to 4273566 (45 bp); Terriglobus saanensis SP1PR4 TCCACCACCACCGGGCCCACCACCTCCCGGTCCTCCACCACCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4270835-4274362	Sequence	AciPR4_3533 - hypothetical protein (Protein is coded in complementary strand; from 4274362 to 4270835)