Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 4204598
End position: 4204624
Length: 27

DNA sequence
>NC_014963, from 4204598 to 4204624 (27 bp); Terriglobus saanensis SP1PR4 GGCCACCACGACCACCACCGCCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4204351-4207272	Sequence	AciPR4_3484 - Cna B-type protein (Protein is coded in complementary strand; from 4207272 to 4204351)