Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 2387032
End position: 2387055
Length: 24

DNA sequence
>NC_014963, from 2387032 to 2387055 (24 bp); Terriglobus saanensis SP1PR4 AAGGCGAAGGCCATGGCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2386816-2387826	Sequence	AciPR4_1988 - hopanoid-associated sugar epimerase (Protein is coded in complementary strand; from 2387826 to 2386816)