Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 1690091
End position: 1690135
Length: 45

DNA sequence
>NC_014963, from 1690091 to 1690135 (45 bp); Terriglobus saanensis SP1PR4 ACCACGACGACAAGTACAACGACGACCACTACAACGACGACAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1688937-1691396	Sequence	AciPR4_1405 - type II and III secretion system protein