Sequence retrieval

Genome: Terriglobus saanensis SP1PR4
Start position: 2223490
End position: 2223513
Length: 24

DNA sequence
>NC_014963, from 2223490 to 2223513 (24 bp); Terriglobus saanensis SP1PR4 GACGATGAGGATGAGGATGACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2221283-2223682	Sequence	AciPR4_1847 - polyribonucleotide nucleotidyltransferase