Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 822288
End position: 822317
Length: 30

DNA sequence
>NC_014934, from 822288 to 822317 (30 bp); Cellulophaga algicola DSM 14237 TCTTCTTTGTTCTTTTTTGATTTTCGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 820704-822389	Sequence	Celal_0739 - type i phosphodiesterase/nucleotide pyrophosphatase (Protein is coded in complementary strand; from 822389 to 820704)