Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 757668
End position: 757691
Length: 24

DNA sequence
>NC_014934, from 757668 to 757691 (24 bp); Cellulophaga algicola DSM 14237 ACCACCACGACCACCATCTCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 756805-757806	Sequence	Celal_0668 - gtpase obg (Protein is coded in complementary strand; from 757806 to 756805)