Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 4206952
End position: 4206975
Length: 24

DNA sequence
>NC_014934, from 4206952 to 4206975 (24 bp); Cellulophaga algicola DSM 14237 TTTTTATTCTTATTATTAGTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4206974-4208158	Sequence	Celal_3674 - hypothetical protein (Protein is coded in complementary strand; from 4208158 to 4206974)