Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 3660955
End position: 3660984
Length: 30

DNA sequence
>NC_014934, from 3660955 to 3660984 (30 bp); Cellulophaga algicola DSM 14237 AAGTTTTTTTCATTTTTTTTAAATTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3660379-3661173	Sequence	Celal_3187 - hypothetical protein (Protein is coded in complementary strand; from 3661173 to 3660379)