Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 337157
End position: 337192
Length: 36

DNA sequence
>NC_014934, from 337157 to 337192 (36 bp); Cellulophaga algicola DSM 14237 TTCTTCCTTTGCTTCTTCTTTTACTTCTTCTTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 337134-337580	Sequence	Celal_0306 - hypothetical protein (Protein is coded in complementary strand; from 337580 to 337134)