Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 2728443
End position: 2728478
Length: 36

DNA sequence
>NC_014934, from 2728443 to 2728478 (36 bp); Cellulophaga algicola DSM 14237 AAAGGAGATCAAGGAGATCAAGGAGATCAAGGAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2722960-2728911	Sequence	Celal_2387 - collagen triple helix repeat-containing protein