Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 2381712
End position: 2381738
Length: 27

DNA sequence
>NC_014934, from 2381712 to 2381738 (27 bp); Cellulophaga algicola DSM 14237 CTGAAGTTGCTGAAGTTGCTGAAATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2381406-2382125	Sequence	Celal_2078 - outer membrane transport energization protein tonb