Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 2197217
End position: 2197246
Length: 30

DNA sequence
>NC_014934, from 2197217 to 2197246 (30 bp); Cellulophaga algicola DSM 14237 AGCTTTAGCTCTAGCTTCTGCTTTCGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2197089-2197613	Sequence	Celal_1921 - 30S ribosomal protein S16 (Protein is coded in complementary strand; from 2197613 to 2197089)