Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 2017555
End position: 2017578
Length: 24

DNA sequence
>NC_014934, from 2017555 to 2017578 (24 bp); Cellulophaga algicola DSM 14237 TTTTGTTATTGTGTTTGTTTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2016005-2019514	Sequence	Celal_1766 - acriflavin resistance protein (Protein is coded in complementary strand; from 2019514 to 2016005)