Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 1896671
End position: 1896695
Length: 25

DNA sequence
>NC_014934, from 1896671 to 1896695 (25 bp); Cellulophaga algicola DSM 14237 ATTTAATTTCTTTTATTTTAATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1895950-1896786	Sequence	Celal_1646 - hypothetical protein (Protein is coded in complementary strand; from 1896786 to 1895950)