Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 175188
End position: 175217
Length: 30

DNA sequence
>NC_014934, from 175188 to 175217 (30 bp); Cellulophaga algicola DSM 14237 CATGTTTTTTAATGTTTTCTGATATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 175172-176170	Sequence	Celal_0166 - hypothetical protein (Protein is coded in complementary strand; from 176170 to 175172)