Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 1593273
End position: 1593308
Length: 36

DNA sequence
>NC_014934, from 1593273 to 1593308 (36 bp); Cellulophaga algicola DSM 14237 TTCTTCCTCTTCTTCATCCTCTTCTTCTTCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1592647-1593807	Sequence	Celal_1376 - sodium/calcium exchanger membrane region (Protein is coded in complementary strand; from 1593807 to 1592647)