Sequence retrieval

Genome: Cellulophaga algicola DSM 14237
Start position: 4321249
End position: 4321273
Length: 25

DNA sequence
>NC_014934, from 4321249 to 4321273 (25 bp); Cellulophaga algicola DSM 14237 TAATTTCATTAAATTTATTTAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4321182-4322900	Sequence	Celal_3770 - hypothetical protein (Protein is coded in complementary strand; from 4322900 to 4321182)