Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 903728
End position: 903754
Length: 27

DNA sequence
>NC_014910, from 903728 to 903754 (27 bp); Alicycliphilus denitrificans BC CTCACTTCACTCACTTCACTTACTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 903748-905253	Sequence	Alide_0850 - methylmalonate-semialdehyde dehydrogenase (Protein is coded in complementary strand; from 905253 to 903748)