Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 869466
End position: 869501
Length: 36

DNA sequence
>NC_014910, from 869466 to 869501 (36 bp); Alicycliphilus denitrificans BC GCCCATGCCGCCCATGCCACCCATGCCGCCCATGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 869461-871107	Sequence	Alide_0818 - molecular chaperone GroEL (Protein is coded in complementary strand; from 871107 to 869461)