Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 821802
End position: 821825
Length: 24

DNA sequence
>NC_014910, from 821802 to 821825 (24 bp); Alicycliphilus denitrificans BC CCAGCGCCTGCGCCTGCGCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 821261-821914	Sequence	Alide_0774 - 2OG-Fe(II) oxygenase (Protein is coded in complementary strand; from 821914 to 821261)