Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 483136
End position: 483159
Length: 24

DNA sequence
>NC_014910, from 483136 to 483159 (24 bp); Alicycliphilus denitrificans BC CATCGACATCGAGATCGAGATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 482565-486794	Sequence	Alide_0463 - DNA-directed RNA polymerase, beta' subunit