Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 462279
End position: 462308
Length: 30

DNA sequence
>NC_014910, from 462279 to 462308 (30 bp); Alicycliphilus denitrificans BC CCGCCGCGGCCGCCGCCCCAGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 462192-463079	Sequence	Alide_0446 - hypothetical protein (Protein is coded in complementary strand; from 463079 to 462192)