Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 4435395
End position: 4435424
Length: 30

DNA sequence
>NC_014910, from 4435395 to 4435424 (30 bp); Alicycliphilus denitrificans BC GGCGGCGCACGTCGCCGCACAGCGGCGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4434560-4435663	Sequence	Alide_4236 - mlta domain protein (Protein is coded in complementary strand; from 4435663 to 4434560)