Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 4408876
End position: 4408911
Length: 36

DNA sequence
>NC_014910, from 4408876 to 4408911 (36 bp); Alicycliphilus denitrificans BC GACCAGCACCACGGCCAGCACCACGGCCAGCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4407428-4409161	Sequence	Alide_4215 - 2-aminoethylphosphonate abc transport system, permease protein (Protein is coded in complementary strand; from 4409161 to 4407428)