Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 4083921
End position: 4083944
Length: 24

DNA sequence
>NC_014910, from 4083921 to 4083944 (24 bp); Alicycliphilus denitrificans BC GCAGCATCAGCAGCGGCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4083665-4084411	Sequence	Alide_3909 - hypothetical protein (Protein is coded in complementary strand; from 4084411 to 4083665)