Sequence retrieval

Genome: Alicycliphilus denitrificans BC
Start position: 3764870
End position: 3764893
Length: 24

DNA sequence
>NC_014910, from 3764870 to 3764893 (24 bp); Alicycliphilus denitrificans BC GCAGCTCCAGCTGCAGCAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3764026-3765687	Sequence	Alide_3621 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 3765687 to 3764026)